ID: 949521415_949521416

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 949521415 949521416
Species Human (GRCh38) Human (GRCh38)
Location 3:4858021-4858043 3:4858046-4858068
Sequence CCTGTTTTCTTCTAGAACAGCAT TACAATATAACTTTCTGTTATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 21, 4: 229} {0: 1, 1: 0, 2: 3, 3: 22, 4: 268}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!