ID: 949588379_949588384

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 949588379 949588384
Species Human (GRCh38) Human (GRCh38)
Location 3:5466243-5466265 3:5466273-5466295
Sequence CCTATTTCCCAATGTACTCATTT TAGAAGGCTAAGATTTGGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 424} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!