ID: 949592371_949592375

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 949592371 949592375
Species Human (GRCh38) Human (GRCh38)
Location 3:5507922-5507944 3:5507943-5507965
Sequence CCGATGTTTAAAGGATGGGAAAT ATGGAAAAGGAGACTCAGGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 5, 3: 60, 4: 628}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!