ID: 949670933_949670945

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 949670933 949670945
Species Human (GRCh38) Human (GRCh38)
Location 3:6398561-6398583 3:6398613-6398635
Sequence CCACCTTTCTGGGGGGCAAGAAA GGCAAGTCCCGCTTTTGTAGGGG
Strand - +
Off-target summary {0: 45, 1: 26, 2: 48, 3: 193, 4: 567} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!