ID: 949670934_949670945

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 949670934 949670945
Species Human (GRCh38) Human (GRCh38)
Location 3:6398564-6398586 3:6398613-6398635
Sequence CCTTTCTGGGGGGCAAGAAACCC GGCAAGTCCCGCTTTTGTAGGGG
Strand - +
Off-target summary {0: 70, 1: 42, 2: 9, 3: 11, 4: 128} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!