ID: 949710192_949710211

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 949710192 949710211
Species Human (GRCh38) Human (GRCh38)
Location 3:6862724-6862746 3:6862766-6862788
Sequence CCCCCCGCCCCCCTCACCCACTA AAGCCAAATCCTCGGCTTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 87, 4: 1037} {0: 1, 1: 0, 2: 0, 3: 6, 4: 103}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!