ID: 949725643_949725648

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 949725643 949725648
Species Human (GRCh38) Human (GRCh38)
Location 3:7041268-7041290 3:7041294-7041316
Sequence CCTGTCTCCCTCTAATTCTCCTG CCTTCCACCTTCCCATTCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 34, 4: 569} {0: 1, 1: 0, 2: 4, 3: 56, 4: 487}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!