ID: 949751088_949751093

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 949751088 949751093
Species Human (GRCh38) Human (GRCh38)
Location 3:7353494-7353516 3:7353523-7353545
Sequence CCATGAATGAGCTGGAGATGCCT CCTTGGTTTACTGTAGAGAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 10, 3: 14, 4: 151} {0: 1, 1: 11, 2: 170, 3: 216, 4: 297}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!