ID: 949756597_949756606

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 949756597 949756606
Species Human (GRCh38) Human (GRCh38)
Location 3:7418577-7418599 3:7418614-7418636
Sequence CCTACCCACAGCCCACCAGCTGA GAGACTTGCCAGGATGCTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 38, 4: 418} {0: 1, 1: 0, 2: 1, 3: 21, 4: 208}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!