ID: 949835144_949835147

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 949835144 949835147
Species Human (GRCh38) Human (GRCh38)
Location 3:8260169-8260191 3:8260207-8260229
Sequence CCCACATAGAGTTTTGCAGTATC AAACTCATACTGTCATACTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 118} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!