ID: 949878320_949878332

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 949878320 949878332
Species Human (GRCh38) Human (GRCh38)
Location 3:8641613-8641635 3:8641655-8641677
Sequence CCCGAAGTGTGCAGCCTGTGGGA GAGGCCAGGGCTAACCTAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 160} {0: 1, 1: 0, 2: 0, 3: 8, 4: 102}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!