ID: 949878324_949878328

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 949878324 949878328
Species Human (GRCh38) Human (GRCh38)
Location 3:8641627-8641649 3:8641642-8641664
Sequence CCTGTGGGAAAGACCAGATGGGC AGATGGGCCCCTAGAGGCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 156} {0: 1, 1: 0, 2: 0, 3: 30, 4: 240}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!