|
Left Crispr |
Right Crispr |
| Crispr ID |
949884908 |
949884913 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:8685054-8685076
|
3:8685069-8685091
|
| Sequence |
CCTCTCTCCCTCTGGATATGAGG |
ATATGAGGAAGATTTTCCCAGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 3, 1: 21, 2: 73, 3: 319, 4: 868} |
{0: 1, 1: 4, 2: 9, 3: 48, 4: 426} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|