|
Left Crispr |
Right Crispr |
Crispr ID |
949884908 |
949884918 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
3:8685054-8685076
|
3:8685095-8685117
|
Sequence |
CCTCTCTCCCTCTGGATATGAGG |
TGTACACCCCCTGCGATATTGGG |
Strand |
- |
+ |
Off-target summary |
{0: 3, 1: 21, 2: 73, 3: 319, 4: 868} |
{0: 162, 1: 699, 2: 1290, 3: 1803, 4: 1767} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|