ID: 949895436_949895439

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 949895436 949895439
Species Human (GRCh38) Human (GRCh38)
Location 3:8764700-8764722 3:8764728-8764750
Sequence CCAGGCTGGTGGTGGCCAGAGTC CATCACCTCTGTGTTTGATGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 307} {0: 1, 1: 0, 2: 1, 3: 14, 4: 215}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!