ID: 949915564_949915570

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 949915564 949915570
Species Human (GRCh38) Human (GRCh38)
Location 3:8961056-8961078 3:8961099-8961121
Sequence CCCAGAAGCCAGAACCAGTCTAT ATGCCATCCTCTTCTGGTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 147} {0: 1, 1: 0, 2: 0, 3: 7, 4: 145}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!