ID: 949925867_949925877

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 949925867 949925877
Species Human (GRCh38) Human (GRCh38)
Location 3:9041190-9041212 3:9041241-9041263
Sequence CCCAAGTCCCTGCTAAGTGTAGA TTCAAGTCTAAGTTTACCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 126} {0: 1, 1: 0, 2: 0, 3: 17, 4: 141}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!