ID: 949925879_949925883

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 949925879 949925883
Species Human (GRCh38) Human (GRCh38)
Location 3:9041257-9041279 3:9041275-9041297
Sequence CCCAGGGAAGCTGGTTCCACCTC ACCTCCACAAACACAAGGTGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 17, 4: 199} {0: 1, 1: 0, 2: 0, 3: 19, 4: 226}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!