ID: 949925880_949925883

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 949925880 949925883
Species Human (GRCh38) Human (GRCh38)
Location 3:9041258-9041280 3:9041275-9041297
Sequence CCAGGGAAGCTGGTTCCACCTCC ACCTCCACAAACACAAGGTGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 29, 4: 232} {0: 1, 1: 0, 2: 0, 3: 19, 4: 226}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!