ID: 949926055_949926059

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 949926055 949926059
Species Human (GRCh38) Human (GRCh38)
Location 3:9042765-9042787 3:9042787-9042809
Sequence CCATGAAAGTGGTCAGGCGATGG GCCTGGGATTGTAGTGAACAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 71} {0: 1, 1: 0, 2: 1, 3: 14, 4: 177}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!