ID: 949929651_949929656

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 949929651 949929656
Species Human (GRCh38) Human (GRCh38)
Location 3:9068792-9068814 3:9068827-9068849
Sequence CCTTCCAGGAGCCCTTCTAGTAA ATGAGTCCTTTCCCTAATCCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 10, 4: 101} {0: 1, 1: 0, 2: 0, 3: 16, 4: 131}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!