ID: 949940121_949940123

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 949940121 949940123
Species Human (GRCh38) Human (GRCh38)
Location 3:9148337-9148359 3:9148354-9148376
Sequence CCAGCAATTTTGGGGGCAGTGCC AGTGCCTCATGGTGTCATGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 456} {0: 1, 1: 0, 2: 1, 3: 19, 4: 242}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!