ID: 949941118_949941121

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 949941118 949941121
Species Human (GRCh38) Human (GRCh38)
Location 3:9155491-9155513 3:9155510-9155532
Sequence CCTCCATTCTCTTCTTCTGGAAC GAACTCTGCTTGGCATATACTGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 7, 3: 36, 4: 427} {0: 1, 1: 0, 2: 0, 3: 13, 4: 153}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!