ID: 949941119_949941121

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 949941119 949941121
Species Human (GRCh38) Human (GRCh38)
Location 3:9155494-9155516 3:9155510-9155532
Sequence CCATTCTCTTCTTCTGGAACTCT GAACTCTGCTTGGCATATACTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 21, 3: 114, 4: 642} {0: 1, 1: 0, 2: 0, 3: 13, 4: 153}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!