|
Left Crispr |
Right Crispr |
| Crispr ID |
949944101 |
949944105 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:9176662-9176684
|
3:9176703-9176725
|
| Sequence |
CCAATCATGGTGGAAGTCAAAGT |
CTGTAAAAGCAGAAGCAAGTGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 15, 2: 125, 3: 301, 4: 842} |
{0: 1, 1: 1, 2: 37, 3: 79, 4: 436} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|