|
Left Crispr |
Right Crispr |
| Crispr ID |
949967760 |
949967771 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:9373181-9373203
|
3:9373234-9373256
|
| Sequence |
CCGTGCTGCATTGGTTTAAATCC |
TGTAATCCCAGCACTTTGGGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 1, 2: 1, 3: 24, 4: 272} |
{0: 288135, 1: 266162, 2: 155564, 3: 133776, 4: 191789} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|