ID: 949973405_949973410

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 949973405 949973410
Species Human (GRCh38) Human (GRCh38)
Location 3:9431334-9431356 3:9431386-9431408
Sequence CCTGGTTTCTGTGTATGTGTCCA TTACATTTGCATAAAGTGGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 49, 4: 388} {0: 1, 1: 0, 2: 1, 3: 21, 4: 242}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!