ID: 949980843_949980848

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 949980843 949980848
Species Human (GRCh38) Human (GRCh38)
Location 3:9500877-9500899 3:9500892-9500914
Sequence CCAAGGGGAAGGGAGACGCCCCC ACGCCCCCACAGTGGGTGGAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 43, 4: 270} {0: 1, 1: 0, 2: 1, 3: 8, 4: 127}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!