ID: 949982011_949982020

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 949982011 949982020
Species Human (GRCh38) Human (GRCh38)
Location 3:9508015-9508037 3:9508054-9508076
Sequence CCAGGTCCACAGGGTGCTTAGCC GCAATGTAAAGTGGGGGTGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 133} {0: 1, 1: 0, 2: 3, 3: 12, 4: 213}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!