ID: 949988568_949988572

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 949988568 949988572
Species Human (GRCh38) Human (GRCh38)
Location 3:9559170-9559192 3:9559216-9559238
Sequence CCATCTGAGTTCCATTTCTGCAC AGTTTCCTCATCTTTAAAGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 239} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!