ID: 949996538_949996549

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 949996538 949996549
Species Human (GRCh38) Human (GRCh38)
Location 3:9621776-9621798 3:9621818-9621840
Sequence CCACCTCGACCTCCCAAAGTGCT ACCATGCTGGGCCTACAAGTAGG
Strand - +
Off-target summary {0: 2438, 1: 95371, 2: 188205, 3: 135654, 4: 71168} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!