ID: 950008460_950008468

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 950008460 950008468
Species Human (GRCh38) Human (GRCh38)
Location 3:9705681-9705703 3:9705712-9705734
Sequence CCTCTTCCTTCTTGGCTGCCACT CTGCAGAAGGTGAGGCTGAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 30, 4: 460} {0: 1, 1: 0, 2: 1, 3: 49, 4: 432}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!