ID: 950030922_950030927

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 950030922 950030927
Species Human (GRCh38) Human (GRCh38)
Location 3:9852829-9852851 3:9852858-9852880
Sequence CCGATACTGAAATTCAGCCGGCA ATTGATAAGCTACTGGTGGTTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 11, 3: 18, 4: 75} {0: 4, 1: 11, 2: 20, 3: 14, 4: 116}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!