ID: 950033385_950033387

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 950033385 950033387
Species Human (GRCh38) Human (GRCh38)
Location 3:9866799-9866821 3:9866816-9866838
Sequence CCAGAAGGTAGAGAGCACCATGA CCATGAAAGTACAGCCTGCGAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 19, 4: 204} {0: 1, 1: 1, 2: 0, 3: 8, 4: 63}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!