ID: 950040898_950040910

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 950040898 950040910
Species Human (GRCh38) Human (GRCh38)
Location 3:9918400-9918422 3:9918446-9918468
Sequence CCTAGGAATGGTGAGGAGAACCT AAGGCCTGGCCTGCCGCTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 192} {0: 1, 1: 0, 2: 2, 3: 18, 4: 257}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!