ID: 950043237_950043252

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 950043237 950043252
Species Human (GRCh38) Human (GRCh38)
Location 3:9933502-9933524 3:9933533-9933555
Sequence CCCTGGATAGCTACTTCCATCCC TCCCGCGCCGGGACGCGGGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 151} {0: 1, 1: 0, 2: 3, 3: 16, 4: 144}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!