ID: 950052137_950052146

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 950052137 950052146
Species Human (GRCh38) Human (GRCh38)
Location 3:10000288-10000310 3:10000337-10000359
Sequence CCTCGGCCTCCCAAAGTGCTAGG GCCTCTATTAAGTTTTAAGATGG
Strand - +
Off-target summary {0: 7193, 1: 136299, 2: 273280, 3: 205953, 4: 123893} {0: 1, 1: 1, 2: 1, 3: 10, 4: 183}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!