ID: 950056204_950056216

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 950056204 950056216
Species Human (GRCh38) Human (GRCh38)
Location 3:10026672-10026694 3:10026718-10026740
Sequence CCCTCACCCGCTTCCCGATGAAC TCACTTCTGTTGGGCTTTTCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 2, 4: 63} {0: 1, 1: 0, 2: 1, 3: 9, 4: 249}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!