ID: 950056814_950056820

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 950056814 950056820
Species Human (GRCh38) Human (GRCh38)
Location 3:10031697-10031719 3:10031725-10031747
Sequence CCTTCCCCATTCTGTCTACCCTT AGATCATTGAGTCTCAAATTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 35, 4: 527} {0: 1, 1: 0, 2: 3, 3: 31, 4: 226}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!