ID: 950095379_950095385

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 950095379 950095385
Species Human (GRCh38) Human (GRCh38)
Location 3:10326409-10326431 3:10326457-10326479
Sequence CCTGGCTCCGAATGAACATGGAG GATGTCATGGAACGAGGTCACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 95} {0: 1, 1: 0, 2: 0, 3: 4, 4: 92}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!