ID: 950113338_950113349

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 950113338 950113349
Species Human (GRCh38) Human (GRCh38)
Location 3:10434684-10434706 3:10434722-10434744
Sequence CCCCATGGCCAGGCCCTGTCAAG CAGCCTCCAACCCCTGGGTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 205} {0: 1, 1: 0, 2: 8, 3: 50, 4: 416}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!