ID: 950117001_950117006

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 950117001 950117006
Species Human (GRCh38) Human (GRCh38)
Location 3:10457434-10457456 3:10457469-10457491
Sequence CCGTGCTTTGTGTGTGGGAAAGA TGTATCAGTGGACATGTGGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 273} {0: 1, 1: 0, 2: 0, 3: 16, 4: 200}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!