ID: 950117602_950117611

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 950117602 950117611
Species Human (GRCh38) Human (GRCh38)
Location 3:10461623-10461645 3:10461636-10461658
Sequence CCCACCCTGCAGAGATGAATGAG GATGAATGAGCGGATGGTGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 192} {0: 1, 1: 0, 2: 2, 3: 13, 4: 313}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!