ID: 950119937_950119945

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 950119937 950119945
Species Human (GRCh38) Human (GRCh38)
Location 3:10475036-10475058 3:10475079-10475101
Sequence CCAGTTTCAGCCTGGGCTTCTGC GGACGGTTAAGAGAGGGAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 42, 4: 303} {0: 1, 1: 0, 2: 2, 3: 45, 4: 514}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!