ID: 950121485_950121496

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 950121485 950121496
Species Human (GRCh38) Human (GRCh38)
Location 3:10484996-10485018 3:10485024-10485046
Sequence CCTTAAGCTGACCTGACGCAGAC CTGTGAAAGGGGCTGGTTGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 58} {0: 1, 1: 0, 2: 0, 3: 27, 4: 271}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!