ID: 950131295_950131300

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 950131295 950131300
Species Human (GRCh38) Human (GRCh38)
Location 3:10548556-10548578 3:10548570-10548592
Sequence CCCTTCCCTCTCAGCTGGGAAAA CTGGGAAAACCATGAGCTGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 324} {0: 1, 1: 0, 2: 0, 3: 31, 4: 241}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!