ID: 950158109_950158114

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 950158109 950158114
Species Human (GRCh38) Human (GRCh38)
Location 3:10739064-10739086 3:10739095-10739117
Sequence CCCTGGTGTCCAATGAAAGAGGC CGTTAAGTGCAGATCTTCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 136} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!