ID: 950161434_950161445

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 950161434 950161445
Species Human (GRCh38) Human (GRCh38)
Location 3:10764038-10764060 3:10764081-10764103
Sequence CCTGTTGCCTTCCCCTCACTCAC CAGAGCTCAACTCACATCCGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 4, 4: 90}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!