ID: 950178053_950178067

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 950178053 950178067
Species Human (GRCh38) Human (GRCh38)
Location 3:10889870-10889892 3:10889918-10889940
Sequence CCCACCTGCCCTCGCTCCCATGC CACTTCAGAGCTTCCTGCAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 402} {0: 1, 1: 0, 2: 1, 3: 15, 4: 173}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!