ID: 950181104_950181115

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 950181104 950181115
Species Human (GRCh38) Human (GRCh38)
Location 3:10914067-10914089 3:10914117-10914139
Sequence CCATACCCCTGCTGGTGGGACAG GGGTCATCATGTGGCTCGAGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 11, 4: 186} {0: 1, 1: 0, 2: 0, 3: 4, 4: 68}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!